
Twitter Wall


Meet Ezinne - the UK's best Spanish student! 🇪🇸 Having won in 2019-20, Ezinne was finally able to receive her certificate and coveted prize of a bursary for further Spanish studies in Spain. Congratulations to Ezinne for achieving this impressive feat. 👏


Retweeted From CRUK Blackheath shop

🧡Thank you to all the amazing teachers, staff & pupils from the wonderful 4 raising over £922 for 👏. Such a fabulous school, with heart & soul, that takes the time to make a difference, thank you all so much🧡🙏🏼🧡


Recently, Year 13 student, Carla, attended the prestigious French acting school, Les Cours Florent in Marseilles. 🇫🇷 This wonderful experience was made possible by our MFL Sixth Form Scholarship. Read Carla's full recount 👇


If you have a little one at home, our Director of Music and Music Scholars would like to invite you to 'Classics for Kids' - a 30-minute musical adventure, introducing little people and their grown-ups to a range of music and sounds. 🎶 Book your space 👇


Throughout October, we have participated in a range of activities for . There have been talks from guest speakers such as , assemblies on Black familial history, and so much more; because, at BHS, the things that make us different are celebrated.


Our girls did an absolutely fantastic job of designing and creating their own kites at home and in their lessons last week! 🪁 Here they are at 's kite day on Sunday, proudly taking their kites to the skies. 👇


Such a spectacular array of donations from our Junior girls and their families for the Harvest Festival!🍂 What a wonderful way to bring the start of the autumn term to a close: with generosity and compassion. 💫


Retweeted From CRUK Blackheath shop

🧡Thank you so much wonderful seniors & juniors 4 doing a mufti today 4 🧡. So important & crucial 2 raise awareness & funds. Mrs B looks awesome & we’re sure you will all have a fabulous day. Thank you🙏🏼🧡👏💥


Congratulations to our cross country teams👏- what an impressive, well-deserved feat! 🏆


Our Science lessons have started strong this term. Both students and teachers are excited to be taking part in practical experiments. In Year 12, girls have been dissecting fish heads to study gill arcs and filaments, for their new topic 'Transport in Animals' - fascinating!


Good luck, girls! 🤞


We were delighted to host you - thank you for sharing your story with us.


Our Year 6, 8 and 9 girls loved showing visitors around at our School in Action mornings this week. Registration is still open for next week's School in Action mornings. Book your space here to experience our vibrant teaching environment live in-person >


Retweeted From Carol Chandler-Thomp

We are very excited to welcome and students from the to for a Wollstonecraft Speaker Series special tomorrow...the students have been thinking hard about good questions!🤔


Our Junior School girls have been set the challenge of making a kite that they can fly at 's kite day on Sunday. Nursery to Year 5 will make theirs at home and Year 6 will be getting stuck-in in their DT lessons. We can't wait to see their innovative creations! 🪁


Our Year 8 girls are putting on their detective hats to try and uncover the mystery of the injured science teacher. Let's hope they solve the case before home time! 🕵️‍♀️


It was such a pleasure to open our doors and welcome guests to our Open Morning last week. It is always wonderful to see visitors engaging with our creative, diverse community, and we can't wait to welcome guests back again to our School in Action mornings next week.


Our Mighty Girls enjoyed welcoming guests to the Junior School Open Morning on Saturday. They will also be at our School in Action mornings on 7 & 13 October to tell you more about the Mighty Girls Challenge and how it motivates our girls. Register here -


There's still time to register for our Sixth Form Virtual Q&A taking place tomorrow. Book your place to engage with our Sixth Form Leadership Team and our Sixth Form students to find out what makes the Blackheath High A-Level experience unique -


Retweeted From Carol Chandler-Thomp

Ready to open our doors this morning - wonderful to be able to welcome visitors safely and warmly onto our site at last!


We encourage our girls to be daring. Discover Blackheath High Junior School GDST at our Open Morning 25 September – book now:


A massive congratulations to our sports scholar, Marley, who competed at the Inter-Regional Champs for British Triathlon last week. After qualifying for the main final, Marley pushed herself and finished 9th in her age group in the entire UK - incredible!


Our Sixth Form girls are courageous and insightful. Speak with our Sixth Form Leadership Team at our Virtual Open Evening and Live Q&A on Wednesday 29 September to find out what makes Blackheath High Sixth Form unique – book now:


Our Senior School students loved receiving their 'welcome' tote bags at the start of term. These eco-friendly, reusable bags were designed by one our talented Year 13 Textiles students, Lumina, who will be starting at the University of Bath this year.


It's societies week! Last week our Sixth Form students advertised their societies in a whole school assembly, and this week our senior girls will be choosing which society they would like to join. They can choose from a wide range, from Art, to Film, to Law and many more.


We support and encourage our girls all the way from Nursery to Sixth Form. Book your space at our Open Morning on Saturday 25 September and take a tour of our new Sixth Form Centre to see how we can prepare you for university and beyond – sign up now:


Last week we celebrated the achievements of our wonderful Year 11 and 13 students at our Valedictory Ceremony. There were music and dance performances by our students, and an inspiring speech from . Needless to say, it was a fantastic evening.


It was such an honour to host the Sixth Form ball for our recently graduated Year 13 students this month. Everyone had a wonderful time celebrating their achievements with their friends and former teachers as they prepare to move into the world of higher education.


GCSE and A-Level art displays are being put up across the school today. Each year we celebrate the amazing talents of our art students with an exhibition where their work goes on display for all to enjoy. This year's exhibition will be taking place next Tuesday.


Today is our Clubs Fair. At the Clubs Fair, students can choose from a range of exciting extra-curricular clubs to further enrich their studies. Some of our clubs include: 🥋 Chinese Martial Arts in Mandarin 🚲 Bicycle Maintenance 👾 Minecraft & more! Which would you choose?


Wishing a warm welcome back to all of our students. As we step into the new term together, we're looking forward to a fun-filled year and seeing where our girls will Boldly Go.


Retweeted From Brent Pirie

GDST girls from and Norwich High, playing a cracking piece of music. An ethos of collaboration, team work, friendship and supporting each other at a challenging but enjoyable residential week of playing brass 💥🎼👏🙌


We encourage our girls to chase their dreams with conviction. Take a tour of Blackheath High Sixth Form GDST at our Open Morning 25 September – book now:


Having worked though the most challenging of years, our Sixth Form Textiles student have produced the most extraordinary collections and have proved just how creative they can be. Read more about our impressive Sixth Form Fashion Show here:


On Thursday 24 June, we displayed all GCSE and A-level Art work as an exhibition in the Wollstonecraft Room. This featured acrylic paintings, mixed-media and Personal Investigation projects. Well done girls! You can view a gallery of the work here:


Retweeted From Sarah Skevington


Retweeted From BlackheathHigh Sport

Day 3 of the Sports Camp has kicked off with a very competitive game of Capture the Flag.


Retweeted From Ruth Coles

Reviewing brand-new primary Christmas nativities in August for and secretly loving it🎄 🎶. Thanks for asking !


Retweeted From Sarah Skevington


Retweeted From BlackheathHigh Sport

Day 2 of the Sports Camp and we’re having a great time. There’s been dodgeball, hockey, tennis, rounders, netball - the only thing missing is some sunshine ☀️

Latest news

January 21

Senior School Science and Biology Update

In Science and Biology lessons, our girls have shown that they are thriving in guided home learning.

As part of their electric circuit lesson, Year 7 inventively used MS Teams to pass on their happy energy through the circuit they created.

After learning about the Theory of Evolution by Natural Selection, the friendship between Charles Darwin and Alfred Wallace, Year 8S students learned about Extinction Level Events and Fossils.

They researched fossils, preserved remains from a past geological age, and they drew/painted one they found most interesting.

Year 10X started their Biology topic Inheritance after Christmas. They made some DNA models at home to revise their knowledge of the DNA structure, and they decoded a very short sequence of bases (GATAACGCAATTAGTGGGCGCGAGGCTACC). Try it at home using the decoder.

Page Gallery


Category / All Articles


Category / All Articles

Also In the News